miRNA target sequences for 335413.6

Sequence Score Start position(s)
aagagcattgacagtctgctc 6 267
gtccagactgaatttaggcac 5 762
aaggtgaagaaagttacagac 5 39
gagtttggtcttagtgagaac 5 849
gtgtacttcaagagcattgac 5 258
aagaatcctccaggtagttcc 5 357
aacctgctaagtctgtgaagc 5 458
gaataagaaacctgctaagtc 5 450
ggttctgcatttgtcctttcc 5 626
gttcctgatttcagacaagac 5 373
aagaaagttacagacaaattc 5 45
aaagagtcgctgagtttggtc 4 838
gtatttgtagttggctgtgtc 4 744
aagctgcacagagacctgtgc 4 475
actaggtcttactttcatttc 4 722
tggttctgcatttgtcctttc 4 625
gaaagttacagacaaattcac 4 47
tttcctctctaacctttggcc 4 681
tcaagagcattgacagtctgc 4 265
gtcttagtgagaacaataatc 4 856
gtgtccagactgaatttaggc 4 760
gtggaggaataagaaacctgc 4 444
gaatttaggcacacttcagcc 4 771
ctccaggtagttcctgatttc 4 364
gactgaatttaggcacacttc 4 767
agcagtgtgtacttcaagagc 4 252
acagacaaattcacagagagc 4 54
gcctgcagtgccataaagagc 3 222
gcacgtccggcgatcgcttcc 3 125
gatggcggactgctaggagac 3 657
tgcatttgtcctttccagttc 3 631
gagcagagccaaggagccatc 3 186
ccagactgaatttaggcacac 3 764
gacctgtgcctgcctcggttc 3 487
gccataaagagcatgaccgac 3 231
ggaggagcagagccaaggagc 3 182
atgccattgccatgaaggatc 3 292
gtggagtacgcctgcagtgcc 3 213
gtgtgtgtgccaaagagtcgc 3 827
gctgaaggtgaagaaagttac 3 35
gatcgcttccagagctcgctc 3 136
gacagtctgctcaagcatgcc 3 276
gtatgtgctggccaacgagcc 3 77
tcctctctaacctttggccac 3 683
tcacagagagcatgtatgtgc 3 64
cagtgccataaagagcatgac 3 227
acttcaagagcattgacagtc 3 262
gccatctacaccgtggagtac 3 201
gagccaaggagccatctacac 3 191
atgaaggatcagctgaatgcc 3 303
gcacagagacctgtgcctgcc 3 480
gactggctgtcctctgccttc 3 391
aggtagttcctgatttcagac 3 368
ttcagacaagactggctgtcc 3 382
caagaatcctccaggtagttc 3 356
gctaagtctgtgaagctgcac 3 463
agctctgtgttctctgaccac 3 423
atttcagtatttgtagttggc 3 738
tttcagacaagactggctgtc 3 381
gactccaggagcacgtccggc 3 115
aacaaggtgctgcatctgagc 3 513
gcattgacagtctgctcaagc 3 271
ccattgccatgaaggatcagc 3 295
ataaagagcatgaccgacagc 3 234
ctgatttcagacaagactggc 3 377
cacgtggaggaataagaaacc 3 441
catgaaggatcagctgaatgc 3 302
gaaggatcagctgaatgccgc 3 305
tgaatttaggcacacttcagc 3 770
gcgatcgcttccagagctcgc 3 134
gctgtcctctgccttcttctc 3 396
gaggagcagagccaaggagcc 3 183
tctgctcaagcatgccattgc 3 281
agtgccataaagagcatgacc 3 228
taggcacacttcagccttgtc 3 776
gagagcatgtatgtgctggcc 3 69
cctctgccttcttctctggcc 3 401