>603668907F1 cloneID='ChEST610m1' adult adipose
CTGTGGCGGAGAGGGATGGAGGAGCCCGAGATGCAGCTGAAGGTGAAGAAAGTTACAGAC
AAATTCACAGAGAGCATGTATGTGCTGGCCAACGAGCCCTCTGTGGCCCTGTACCGGCTC
CAGGAGCACGTCCGGCGATCGCTTCCAGAGCTCGCTCAGCACAAGTCTGACATGCAGAGC
TGGGAGGAGCAGAGCCAAGGAGCCATCTACACCGTGGAGTACGCCTGCAGTGCCATAAAG
AGCATGACCGACAGCAGTGTGTACTTCAAGAGCATTGACAGTCTGCTCAAGCATGCCATT
GCCATGAAGGATCAGCTGAATGCCGCTCAGGGCCGCAGTGCTGTTGCCCCACAAGCCAAG
AATCCTCCAGGTAGTTCCTGATTTCAGACAAGACTGGCTGTCCTCTGCCTTCTTCTCTGG
CCCAGCTCTGTGTTCTCTGACCACGTGGAGGAATAAGAAACCTGCTAAGTCTGTGAAGCT
GCACAGAGGCCTGTGCCTGCCTCGGTTCCCAGTAACAAGGTGCTGCATCTGAGCAGGAAA
ACCCTGCCACCGGGTTCAGAACTGCCTATGGGGGGTGCTTTGGGGAGCAGTCGTATCCCT
TTCCACAGTGGGAAGGGAAATGGGGTGGTTCTGCATTTGTCCTTTCCAGTTCTTTTTGAT
GGCGGACTGCTAGGAGACATTTTTCCTCTCTAACCTTTTGGCCACAAAAATCTCTCAGAA
AAAAACTAGGTCTTACTTTCATTTCCAGTATTGGTAGGTTGGCTGTGTCCAGACTGAATT
TAGGCACACTTCAGCCTTGTCCAGGGGGTGTACTGCAAGGAGAGCTTTCGTGTGTGTGN

Component of template sequence 335413.6

Download chromatogram file for 603668907F1

Top hit result for BLAST search vs SWISSPROT-TrEMBL

sequence identifier Tissue Blast output Number of BLAST hits Top hit score Top hit accession Top hit description Top hit organism Top hit keywords
603668907F1 adult adipose Not Available 7 3e-46 AAH10931 SIMILAR TO RIKEN CDNA 2310045N01 GENE. Homo sapiens (Human). None

Clones are available for ordering via SourceBio