>603851473F1 cloneID='ChEST848b20' stage 36 heads
CGGAGAGGGATGGAGGAGCCCGAGATGCAGCTGAAGTTACAGACAAATTCACAGAGAGCA
TGTATGTGCTGGCCAACGAGCCCTCTGTGGCCCTGTACCGGCTCCAGGAGCACGTCCGGC
GATCGCTTCCAGAGCTCGCTCAGCACAAGTCTGACATGCAGAGCTGGGAGGAGCAGAGCC
AAGGAGCCATCTACACCGTGGAGTACGCCTGCAGTGCCATAAAGAGCATGACCGACAGCA
GTGTGTACTTCAAGAGCATTGACAGTCTGCTCAAGCATGCCATTGCCATGAAGGATCAGC
TGAATGCCGCTCAGGGCCGCAGTGCTGTTGCCCCACAAGCCAAGAATCCTCCAGGTAGTT
CCTGATTTCAGACAAGACTGGCTGTCCTCTGCCTTCTTCTCTGGCCCAGCTCTGTGTTCT
CTGACCACGTGGAGGAATAAGAAACCTGCTAAGTCTGTGAAGCTGCACAGAGACCTGTGC
CTGCCTCGGTTCCCAGTAACAAGGTG

Component of template sequence 335413.6

Download chromatogram file for 603851473F1

Top hit result for BLAST search vs SWISSPROT-TrEMBL

sequence identifier Tissue Blast output Number of BLAST hits Top hit score Top hit accession Top hit description Top hit organism Top hit keywords
603851473F1 stage 36 heads Not Available 7 1e-40 AAH10931 SIMILAR TO RIKEN CDNA 2310045N01 GENE. Homo sapiens (Human). None

Clones are available for ordering via SourceBio