>603952071F1 cloneID='ChEST913n17' stage 20-21 whole chick embroys
GTTGTTTCCCTTTCTGCAGTTACAGACAAATTCACAGAGAGCATGTATGTGCTGGCCAAC
GAGCCCTCTGTGGCCCTGTACCGACTCCAGGAGCACGTCCGGCGATCGCTTCCAGAGCTC
GCTCAGCACAAGTCTGACATGCAGAGCTGGGAGGAGCAGAGCCAAGGAGCCATCTACACC
GTGGAGTACGCCTGCAGTGCCATAAAGAGCATGACCGACAGCAGTGTGTACTTCAAGAGC
ATTGACAGTCTGCTCAAGCATGCCATTGCCATGAAGGATCAGCTGAATGCCGCTCAGGGC
CGCAGTGCTGTTGCCCCACAAGCCAAGAATCCTCCAGGTAGTTCCTGATTTCAGACAAGA
CTGGCTGTCCTCTGCCTTCTTCTCTGGCCCAGCTCTGTGTTCTCTGACCACGTGGAGGAA
TAAGAAACCTGCTAAGTCTGTGAAGCTGCACAGAGGCCTGTGCCTGCCTCGGTTCCCAGT
AACAAGGTGCTGCATCTGAGCAGGAAAACCCTGCCACCGGGTTCAGAACTGCCTATGGGG
GGTGCTTTGGGGAGCAGTCGTATCCCTTTCCACAGTGGGAAGGGAAATGGGGTGGTTCTG
CATTTGTCCTTTCCAGTTCTTTTTGATGGCGGACTGCTAGGAGACATTTTTCCTCTCTAA
CCTTTGGCCACAAAAATCTCTCAGAAAAAACTAGGTCTTACTTTCATTTCAGTATTTGTA
GTTGGCTGTGTCCCAGACTGAATTTAGGCACACTTCAGCCTGTTCAGGCGGTGTTCTGCA
AGGAGAGCTTTTCGTGTGTGTGCCANAGAGTCGCTGAGTTGGTCTAAGTGAGAACAATAT
ACAAAGGACAA

Component of template sequence 335413.6

Download chromatogram file for 603952071F1

Top hit result for BLAST search vs SWISSPROT-TrEMBL

sequence identifier Tissue Blast output Number of BLAST hits Top hit score Top hit accession Top hit description Top hit organism Top hit keywords
603952071F1 stage 20-21 whole chick embroys Not Available 7 5e-40 AAH10931 SIMILAR TO RIKEN CDNA 2310045N01 GENE. Homo sapiens (Human). None

Clones are available for ordering via SourceBio