>604131547F1 cloneID='ChEST959m11' adult pancreas
GCGGCTCGAGGAGGGATGGAGGAGCCCGAGATGCAGCTGAAGGTGAAGAAAGTTACAGAC
AAATTCACAGAGAGCATGTATGTGCTGGCCAACGAGCCCTCTGTGGCCCTGTACCGGCTC
CAGGAGCACGTCCGGCGATCGCTTCCAGAGCTCGCTCAGCACAAGTCTGACATGCAGAGC
TGGGAGGAGCAGAGCCAAGGAGCCATCTACACCGTGGAGTACGCCTGCAGTGCCATAAAG
AGCATGACCGACAGCAGTGTGTACTTCAAGAGCATTGACAGTCTGCTCAAGCATGCCATT
GCCATGAAGGATCAGCTGAATGCCGCTCAGGGCCGCAGTGCTGTTGCCCCACAAGCCAAG
AATCCTCCAGGTAGTTCCTGATTTCAGACAAGACTGGCTGTCCTCTGCCTTCTTCTCTGG
CCCAGCTCTGTGTTCTCTGACCACGTGGAGGAATAAGAAACCTGCTAAGTCTGTGAAGCT
GCACAGAGGCCTGTGCCTGCCTCGGTTCCCAGTAACAAGGTGCTGCATCTGAGCAGGAAA
ACCCTGCCACCGGGTTCAGAACTGCCTATGGGGGGTGCTTTGGGGAGCAGTCGTATCCCT
TTCCACAGTGGGAAGGGAAATGGGGTGGTTCTGCATTGTCCTTTCCAGTTCTTTTGATGG
CGGACTGCTAGGAGACATTTTTCCTCTCTAACCTTTGGCCACAAAAATCTCTCAGAAAAA
ACTAGGTCTTACTTTCATTTCAGTATTTGTAGTTGGCTGTGTCCAGACTGAATTTTAGGC
ACACTTCAGCCTTGTTCAGGGGGTGGTCTGCCGGGAGAGCTTTTCGTTGTGTGTGCCANA
GAGTC

Component of template sequence 335413.6

Download chromatogram file for 604131547F1

Top hit result for BLAST search vs SWISSPROT-TrEMBL

sequence identifier Tissue Blast output Number of BLAST hits Top hit score Top hit accession Top hit description Top hit organism Top hit keywords
604131547F1 adult pancreas Not Available 7 6e-46 AAH10931 SIMILAR TO RIKEN CDNA 2310045N01 GENE. Homo sapiens (Human). None

Clones are available for ordering via SourceBio